tylarobb99 tylarobb99

25-09-2022
Mathematics

contestada

A truck rental is $30 plus $.40 /mi. Find out how many miles Ken traveled if his bill was $58.80 .

Respuesta :

Otras preguntas

Use these words in a sentence proton neutron and isotope

can you please help me please

What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil

2. How does Oliver violate the rules of the workhouse?

Which is not an improper fraction equal to eight

Piaget believed that language helped foster cognitive development. Please select the best answer from the choices provided True or False

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Which of the following can increase your credit cards APR

Who is Christina LeConte

need help ASAP! A state park is designed in a circular pattern as shown. Mia runs along the circular path from the tennis courts to the petting zoo. How far doe