ricardoalbertosolano ricardoalbertosolano
  • 23-04-2024
  • Mathematics
contestada

Cómo saco 3/5 de 256

Respuesta :

Otras preguntas

7. Which of the following rivers is the world's busiest waterway? A. Rhone B. Rhine C. Danube D. Seine
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what type of sentence tends to express a strong emotion
Is sextillion a real number?
Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes
Need to know if these are correct, and if not what are the correct ones?
what was the key philosophy held by founding fathers
A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign
Which of the following is a danger of exercising in cold temperatures? A. Dehydration B. Hypothermia C. Stroke D. Irritability