Suhayb744 Suhayb744
  • 23-05-2018
  • Business
contestada

When forming a partnership, do you record the book value or fair value?

Respuesta :

nehniece
nehniece nehniece
  • 23-05-2018
You would record the fair value.
Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
Will brainliest correct answer
the amount of money spent weekly on cleaning maintenance and repairs at a large restaurant was observed over a long period of time to be approximately normally
solve by elimination 2x+5y=17 6x-5y=19
which best identifies a cause of the main conflict how a cat played Robinson Crusoe?
In what form do composers use da capo as a notation device? A. Binary B. Ternary C. Both binary and ternary D. Neither binary and ternary
How do I know when to switch the sign (>,<) in an inequality equation?
I need help with writing an equation of the line that is perpendicular to the line and passes through (2, 4)?
An ion has a net charge of 3+. If this ion has 8 protons, how many electrons does it have?
which reactions change the energy of sunlight to energy rich carriers