uzeinia0 uzeinia0

22-09-2018
Mathematics

contestada

Linda can mow 16 lawns in four days. what is the unit rate?

Respuesta :

jayden78 jayden78

22-09-2018

[tex]16 \times 4 = [/tex]

Answer Link

Otras preguntas

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

two plasma membranes are part of the cell envelope of gram positive gram negative

. Give two more right-hand sides in addition to b = (2,5,7) for which equation (4) can be solved. Give two more right-hand sides in addition to b = (2,5,6) for

COMPLETE THE SENTENCE WITH THE ACTIVE OR PASSIVE FORM OF THE VERBS IN BRACKETS. French _______ (speak) in England in the twelfth century. We _______ (give) new

What ocean is at 60 south and 60 east

A DVD mail ordering company is advertising a sale. During the sale, DVD’s are $4 each and the shipping and handling charge is only $7. How many DVD’s can you bu

Find the equation for the line shown on the right. What is the equation for the line shown on the right?

Besides farming, what other occupations existed in ancient Mesopotamia?

how do you find the radius of a circle when given the central angle and arc length arc length = 82 central angle = 135 degrees

2. Which theory of relativity explains the following scenario: "A boy comments to his mother that it seems like we are not moving on this train while another t