haleyncrider14 haleyncrider14
  • 25-01-2019
  • History
contestada

where is the Okefenokee swamp

Respuesta :

Аноним Аноним
  • 25-01-2019

The  Okefenokee Swamp is in Georgia


Answer Link
Mammoet
Mammoet Mammoet
  • 25-01-2019

The peat-filled wetland is straddling the Georgia and Florida state line.

Answer Link

Otras preguntas

What is a bulge that takes place on parts of Earth facing or opposite the moon ? A. Gravity B. High Tide C. Low Tide D.Moon E. Neap Tide F.Spring Tide G. Sun H.
which country has the longest average growing season in asia
The title ‘Eros Turannos’ comes from two Latin words. Given the purpose and tone of the poem, what is the MOST accurate paraphrase for the title Eros Turranos?
16^1/5 x 2^x= 8^3/4 work out the exact value of x.
x = a) 20 b) 60 c) 100
The brave men, living and dead, who struggled here, have consecrated it far above our poor power to add or detract. The world will little note, nor long remembe
Why did the far west attract many freedmen
You are writing a story about a little boy's first visit to the dentist. Which MOST CLEARLY organizes your story to describe this experience? A) Compare his d
The sentinels, facing the banks of the stream, might have been statues to adorn the bridge. Which answer choice BEST defines the word adorn as it is used in t
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt