haleyncrider14 haleyncrider14

25-01-2019
History

contestada

where is the Okefenokee swamp

Respuesta :

Аноним Аноним

25-01-2019

The Okefenokee Swamp is in Georgia

Answer Link

Mammoet Mammoet

25-01-2019

The peat-filled wetland is straddling the Georgia and Florida state line.

Answer Link

Otras preguntas

What is a bulge that takes place on parts of Earth facing or opposite the moon ? A. Gravity B. High Tide C. Low Tide D.Moon E. Neap Tide F.Spring Tide G. Sun H.

which country has the longest average growing season in asia

The title ‘Eros Turannos’ comes from two Latin words. Given the purpose and tone of the poem, what is the MOST accurate paraphrase for the title Eros Turranos?

16^1/5 x 2^x= 8^3/4 work out the exact value of x.

x = a) 20 b) 60 c) 100

The brave men, living and dead, who struggled here, have consecrated it far above our poor power to add or detract. The world will little note, nor long remembe

Why did the far west attract many freedmen

You are writing a story about a little boy's first visit to the dentist. Which MOST CLEARLY organizes your story to describe this experience? A) Compare his d

The sentinels, facing the banks of the stream, might have been statues to adorn the bridge. Which answer choice BEST defines the word adorn as it is used in t

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt