kitkatboy123 kitkatboy123
  • 22-04-2019
  • History
contestada

What effect did the great awaking have on colonies?

Respuesta :

victoriajones10458
victoriajones10458 victoriajones10458
  • 22-04-2019

Answer: First, the Great Awakening affected the colonies by changing many people's attitudes towards religion. Before this revival, religious piety and fervor had been waning in the colonies. The Great Awakening reversed this process and increased the degree to which people felt that religion was important in their lives.

Explanation:

Answer Link

Otras preguntas

what process releases the least atp per molecule of glucose for immediate cell use?
What's 165% as a fraction and decimal
(TCO 4) Which of the following creates thymine dimers? (Points : 4) Nucleotide analogs Nitrous acid Ultraviolet light Benzopyrene Gamma rays
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes
Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp
ratio of 6 to 4 is equal to
During the 1800s, the nations supply of currency was tied to its national reserves of either gold or silver. In 1900, an act was passed by congress that would s
what is 7/8ths of 40
I need somebody's help..