jtipton4631 jtipton4631

24-05-2019
Mathematics

contestada

circle O is shown below. the diagram is not drawn to scale. 73°

circle O is shown below the diagram is not drawn to scale 73 class=

Respuesta :

24-05-2019

Answer:
53.5

Explanation:
Since triangle AOB is an isosceles triangle (AO = OB), the base angles of the triangle are 53.5. (180-73 = 107, 107/2 = 53.5)

Answer Link

alyssammartinezxo alyssammartinezxo

07-06-2019

Answer:

Option A

53.5

Step-by-step explanation:

Answer Link

Otras preguntas

The equation for density is mass divivded by volume.an increase in denstiy can result from all of following expect??

In the humanistic perspective, realization of one's own potential is known as

Which of the following describe the climate conditions of Central Africa? Select all that apply.

why did the almoravids declare war on ghana

What did Americans do in the late 1700s and early 1800s to improve the movement of people and goods

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Kevin has $25. MP3 downloads cost $0.75 each. How many songs can he download and still have $13 left to spend? Write an inequality that represent Kevin’s situat

Which of the following was a main source of prosperity in ancient Ghana?

The medicine capsule shown consists of a cylinder with a hemisphere at each end. The total length of the capsule is 15 millimeters. The diameter is 5 millimeter

Which of the following statements are true of acids and bases? Check all that apply. A. Bases gain an OH- ion when in a solution. B. Acids add H+ ions to