rubikzcube201 rubikzcube201
  • 21-10-2019
  • Mathematics
contestada

Explain why the equation 5|x|-7=7 has only one solution.

Respuesta :

evgeniylevi
evgeniylevi evgeniylevi
  • 21-10-2019

According to the condition, this equation has two solutions: -14/5 and 14/5.

Short explanation:

5|x|=14; ⇔ |x|=14/5; ⇒

[tex]\left[\begin{array}{ccc}x= -\frac{14}{5} \\x= \frac{14}{5} \\\end{array}[/tex]

PS. it's correct, if to substitute the values of 'x' into the condition/equation.

Answer Link

Otras preguntas

what happened when citric acid and and bicarbonate soda mixed together
As the Civil War drew to a conclusion, the chief concern of Republicans in Congress was that
who is the first presiden of United States?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
if probability of a win is 0.24 and the probability of a draw Is 0.16, what is the probability of a loss
what feature of a confederal system did the confederate states of america most want
calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm
Emily buys 4pens for £1 how much would 7 pens cost ?
A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius
The term racial unconscious means that