schoolishard0019 schoolishard0019
  • 25-11-2019
  • Mathematics
contestada

Cramers Rule? I am confused

Cramers Rule I am confused class=

Respuesta :

LammettHash
LammettHash LammettHash
  • 25-11-2019

[tex]D[/tex] is the determinant of the coefficient matrix:

[tex]D=\begin{vmatrix}3&-1\\-3&5\end{vmatrix}=3\times5-(-1)\times(-3)=12[/tex]

[tex]D_x[/tex] is the determinant of the coefficient matrix, but this time you replace the [tex]x[/tex]-coefficients with the values on the right hand side of the equations:

[tex]D_x=\begin{vmatrix}-1&-1\\13&5\end{vmatrix}=(-1)\times5-(-1)\times13=\boxed{8}[/tex]

Answer Link

Otras preguntas

Which prefix means 1/10 of a unit in the metric system
What domain did sues rule?
the sale price of a bicycle is $120 this is 75% of the original price find the original price
What is double consciousness
Emily buys 4pens for £1 how much would 7 pens cost ?
im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?
Work out the Hcf of 32 and 36
If 60 is 75% of a value, what is that value?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
which loan type requires you to make loan payments while you're attending school? A-Unsubsidized federal loan. B-Subsidized federal loan. C-Pell Grant. D-None o