thomaskeithk12
thomaskeithk12 thomaskeithk12
  • 23-01-2020
  • Mathematics
contestada

convert to standard notation ​

convert to standard notation class=

Respuesta :

jpmexican jpmexican
  • 26-01-2020

Answer:

360

Step-by-step explanation:

3.6 E2 means 3.6 times 10^2

3.6*100 = 360

Answer Link

Otras preguntas

On Monday Harold picked up four donuts and two large coffees for the office staff. He paid 4.08. On Tuesday Melinda picked up two donuts and three large coffees
Factor polynomial: 5x^2+21x+4=0
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated
What is the source Code of transcription
Which prefix means 1/10 of a unit in the metric system
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
write a sentence using the words limiting factor and carrying capacity
What impact did Babe Ruth have on the society/country?
E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p
what is the law of conservation of mass?