vampireprincess2005
vampireprincess2005 vampireprincess2005
  • 24-02-2020
  • Business
contestada

Amy's new summer job at the pool will pay her 9$ per hour. which term describes this type of hourly income?

A. salary
B. take-home pay
C. wage
D. all of the above

Respuesta :

aaliyahlowe71
aaliyahlowe71 aaliyahlowe71
  • 24-02-2020

Answer:

D: All of the above.

Explanation:

Answer Link

Otras preguntas

Initially, 0.880 mol of A is present in a 3.00 L solution. 2A(aq)↽−−⇀2B(aq)+C(aq) At equilibrium, 0.150 mol of C is present. Calculate K.
What percentage (to the nearest tenth) of the total hours were completed by students other than Patrick?
Find the face of a rhombus with a circumference of 52 cm and a height of 1.2dm
Select the correct text in the passage. Which sentence includes a transition that signals a basic, fundamental idea? (5) It falls to each of us to be those anxi
sic 2. Which container feels the hottest with the hot water? 3. Why do you think the container in Question 2 feel hot​
Solve for 0 2cot^2 3x=7 cosec 3x -5
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Please help asap Scale Drawings Consider the scale drawing. 1. Find the actual dimensions of the rectangle. 2. Find the actual area of the rectangle. Scale Draw
Define Hierarchical database model:-: [tex] \\ \\ \\ \\ [/tex]​
Think of businesses in your area that you are familiar with or frequently visit. What kind of zoning laws, codes, licenses, and so on do you think these busines