regi5678
regi5678 regi5678
  • 25-02-2020
  • Mathematics
contestada

I need help to find the other sides of the kite. Please help!

I need help to find the other sides of the kite Please help class=

Respuesta :

tkoutsoruais1
tkoutsoruais1 tkoutsoruais1
  • 25-02-2020
Should be 7 if I’m counting right yea 7
Answer Link
jdoe0001 jdoe0001
  • 25-02-2020

Check the picture below.

Ver imagen jdoe0001
Answer Link

Otras preguntas

Which change shows a tenfold increase in concentration of H+ ions ?
a rocket launched into outer space travels 2.4 times 10^5 km during the first 6 hours after launching. what was the rockets average velocity in m/s and km/hr
how did the renaissance transform european society
Ben's father is an alcoholic. Ben hides this from his friends by never having anyone over to the house. What can Ben do to help himself and his father?
On Questions A, D, E
DNA tacaggtacccgaacccaattta
Why do dams have broad base?
How do I find the distance?
What is the standard form equation of 4x+7¥=11
At a local produce market, 3⁄4 of a pint of fresh lemon juice costs $7.65. How much does one pint cost? A. $5.74 B. $11.48 C. $10.20 D.