christinavargas christinavargas

25-07-2016
English

contestada

List four of the five physical features of being a good listener.

Respuesta :

03-08-2016

sit or stand attentively, responding with feedback when appropriate, watch your speaker, and maintain a quiet posture but also attentive

Answer Link

Otras preguntas

A 54.2 L sample of gas at 115 K is heated to 345 K, at constant pressure. What volume does the gas now occupy?

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices

Write an entry for your blog which describes a place you have visited which has affected you or stayed in your memory and explain why this is so

A machine drops 74 milliliters of liquid into a beaker every minute. Using an empty beaker, Sarah started the machine and left the room. When she returned, the

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi

choose the correct helping verb the tadpoles have or had moved into the pond

Indigenous North American societies recognized and even valued a gender status known as (Points : 1) intersexuality. Two Spirits. Hij

list the six external parts of a computer system and identify which are output and which and which are input devices

8 1/4 in simplest form