aprilthomas2005 aprilthomas2005

22-04-2020
Mathematics

contestada

ethan invested £500 in the bank for 2 years.
he earned £40 simple interest in total.

what was the simple interest rate per annum

Respuesta :

gloriaemaikwu123 gloriaemaikwu123

22-04-2020

Answer:

Step-by-step explanation:

I=PRT/100

40=(500XRX2)/100

R=(40X100)/500X2

R=4000/1000

R=4 percent/annum

Answer Link

Otras preguntas

Rory has felt depressed most of the last three years. He also suffers from poor appetite and low self-esteem. Rory most likely has:

2e - 3 - 1/5e = 7/5 + 3e + 4 what does e equal and it is not a true or false question

I don't know if its either A or C You ate in your younger brother’s school canteen and you read what was posted reminder “Clean As You Go.” What will you do? a.

this question is hard

A varies jointly as of the product of b and c. If a = 24 when b = 8 and c = 2, find b when a = 48 and c = 4.

How to make hydroxyquinoline at home with grapefruit and lemon.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Two students run a race. Student A is 50 kg and runs at 5 m/s. Student B is 30 kg and runs at 2 m/s. Which student has more Kinetic energy?

1) According to the global ecological footprint by nation, which country likely has the smallest (per capita) reliance on non-renewable resources? es A) USA B)

Pls help me doing this exercise on congruent triangles.