eduardo7935 eduardo7935
  • 23-04-2020
  • English
contestada

List your qualifications means

List your qualifications means class=

Respuesta :

luciabresee luciabresee
  • 23-04-2020
Answer: d) special skills
Explanation: a qualification is an accomplishment or quality that makes someone suitable for a particular job or activity. An accomplishment would be something that has been achieved, not something like physical qualities (as shown in answer “a”).
Answer Link

Otras preguntas

Which prefix means 1/10 of a unit in the metric system
what feature of a confederal system did the confederate states of america most want
which loan type requires you to make loan payments while you're attending school? A-Unsubsidized federal loan. B-Subsidized federal loan. C-Pell Grant. D-None o
Explain how the delay in marching through Belgium helped France to Survive.
If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold
which of the following is a general way to describe the base pairing rules for DNA
Which of the following correctly describes SAM, a biological methylating agent? A) It contains a Cl bonded to a 1° carbon. B) It contains a methyl group bonded
what are the chromosome numbers of daughter cells in mitosis and meiosis
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How do short-term goals differ from long-term goals?