helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

The ideology that threatened Teddy Roosevelt’s ideal America the most was what?
A plane travels at a constant speed. It takes 6 hours to travel 3360 miles. A. What is the planes speed in miles per hour? B. At this rate, how many miles can i
Taking unrealistic thoughts and expectations and turning them into realistic goals is called Cognitive aligning Cognitive restructuring Cognitive ordering Cogn
Ava bought 6 packages of tulip bulbs and 12 bags of daffodil bulbs for a total of $198. Grace spent $254 buying 14 packages of tulip bulbs and 12 bags of daffod
Find the greatest factor
Consider the angle. Which TWO statements are true?
I really need some help and I would appreciate it! ☺️Faites des comparaisons comme dans le modèle.0. (-) je / manger / elleJemange moins qu'elle1. (=) je / dorm
which was used to by wegner to establish continental drift​
16-2x=-3x+6x+1 what is x
what is 1+2+3+4+5+6+7+8+9+10