ubrajsunr22 ubrajsunr22
  • 21-07-2020
  • English
contestada

what is the meaning of seem​

Respuesta :

samrakshikakoirala
samrakshikakoirala samrakshikakoirala
  • 21-07-2020

Answer:

appear to be,looks like

Explanation:

Answer Link

Otras preguntas

why is marijuana the most widely used drug?
the combined land area of the countries A and B is 147,973 square kilometers. Country A is larger by 673 square kilometers. Determine the land area of each coun
louine bought a computer for 180$ and paid 10.80$ what percent of the cost is the sales tax? (Please help and explain)
The term racial unconscious means that
. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to
Which statement is true for single-celled organisms
write a formula that relates the are A of a triangle to to the lengths of its base b and height h
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.
HELP ASAP!!!!!!!! PLEASE!!!!!! Why does Ralph become the leader of the group at the beginning of the novel? A. because Ralph is manipulative and po
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC