deegan615 deegan615

21-09-2020
History

contestada

Which statement best explains an Enlightenment position on the divine right to rule?

Respuesta :

Аноним Аноним

21-09-2020

Answer:

D. the power of the government is derived from the governed

Explanation:

Answer Link

Otras preguntas

in dogs, wire hair (S) is dominant to smooth (s). Cross of a homozygous wire-haired dog with a smooth-haired dog and show the genotypic and phenotypic ratios.

Please I need help quickly I'm on a time limit

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Please I need help quickly I'm on a time limit

In chapter 1 of " To Kill a Mockingbird", what did Dill dare Jem to do? a. slap Boo Radley's house and run b. go to the town square c. play football with his me

Distinguish between eukaryotic and prokaryotic binary fission.

What are motor proteins? Give 2 examples and describe how they contribute to: 1) directed movement of vesicles in protein transport 2) muscle contraction of ske

The role of media on reporting human rights violation

Which of the following best describes what most experts believe about Homo sapiens? a.they arose out of Africa less than 200,000 years ago b.they arose from Nea

ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,