iarmato1 iarmato1
  • 23-09-2020
  • Mathematics
contestada

Jon has to pay $6.00 admission for the
skating rink and $1.50 per hour to rent
rollerblades. How many hours can he skate
for $25?

Respuesta :

Nyzy
Nyzy Nyzy
  • 23-09-2020
So $6.00 plus the amount of $1.50 a hour so 13 times
Answer Link

Otras preguntas

Please help! 15 points! Which sentence does not provide evidence to support the idea that Thomas Paine uses parallelism to strengthen his argument in The Crisi
Porque el inrrespecto es considerado como un antivalor
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
What are biofertilisiers​
The Dulac Box plant produces 500 cypress packing boxes in two 10-hour shifts. Due to higher demand, they have decided to operate three 8-hour shifts instead wit
Someone please help me ASAP!!
A clinic is now going to make the transition to a computerized system. What steps would you make the transition as smooth as possible?
pls helppp !! i need this as soon as possible!!
15% of £34 how much is 15% out of £34
14 of the kids running the Winterland Fun Run have jingle bells on their shoes. If 56% of the kids running the Winterland Fun Run have jingle bells on their sho