davillohens davillohens

23-10-2016
Mathematics

contestada

How do you write an equation in standard form given point (-1,6) and (3,-2)?

Respuesta :

conversa conversa

23-10-2016

Find the slope
y-y1=m(x-x1)
F(x)=-2x+4

Answer Link

Otras preguntas

Help help math math math

Raul has scraped his knee in the recent after a week it had almost completely healed rho wondered how the skin was able to repair itself while looking exactly t

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Solve for x please help me ****

What is the temperature shown on the thermometer?

another fraction problem. Have tried this one a couple of times and cant find fault in what i did

A scientist recently discovered a pond organism that is unicellular, contain other membrane-bound organelles, and possesses a flagellum. In which ki organism cl

What is the product of using scientific notation to solve the problem of 20.5 * 10 to the 7th power and 0.000036

evaluate the following division: (3b-6a)÷(30a-15b)

Help me solve for x please :))