SecretStupid SecretStupid

25-10-2016
Mathematics

contestada

Can someone please help on me on this question? How would you even solve this?
What is the value of h(-2) when h (x)=3x+1

Respuesta :

LarryPotato LarryPotato

25-10-2016

I'm not sure if this is right but

Ver imagen LarryPotato

Answer Link

Otras preguntas

What is a telomere? What happens to telomeres each time DNA is replicated? How do cells prevent this from occurring?

Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal

15% of 6758 for fun. lets see if you can answer this

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.

What molecule is responsible for determining the fate of each cell

what is similarities and differences freedmen and serfs?

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e

I need help with this quickly please

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC