siulnaranjos siulnaranjos

25-01-2021
Mathematics

contestada

14. Given: trapezoid WXYZ with midsegment ST. If WZ = 15 and ST = 20, find the length
of XY.

A. 10
B. 25
C. 5
D. 35

14 Given trapezoid WXYZ with midsegment ST If WZ 15 and ST 20 find the length of XY A 10 B 25 C 5 D 35 class=

Respuesta :

imdumb220 imdumb220

25-01-2021

Who’s doing school on a Sunday

Answer Link

Otras preguntas

I just need the right answer plz

Where were China's most important ancient cities located? What did these locations have in common?

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

can you write in the scientific notation word problems

What is the mass of one mole of NaCl?

PLEASE HELP!!!!!! Select the correct answer. How did the United Nations help end the Suez Crisis? A. It filed a lawsuit against canal owners. B. It negotiated

A bakery buys flour in 30 pound bags. A batch of cupcakes requires 12 ounces of flour. How many batches of cupcakes can be made with a 30 pound bag of flour?

A ______ is how a company can provide superior customer value to its target market that involves the formulation of a marketing mix. a. market analysis b.

What is the area of this figure? Part 8. NO LINKS!!

Write an equation for a line that goes through the given point and meets the criteria. 1. (3,-2) and perpendicular to y=1/2x+2