BRENlangmalakas BRENlangmalakas
  • 26-01-2021
  • Mathematics
contestada

how many turning points will a quartic fumction with four real zeros have?

Respuesta :

shresthadipasha75
shresthadipasha75 shresthadipasha75
  • 26-01-2021

upto four roots or zero......

Answer Link

Otras preguntas

On the first visit to the veterinarian's office, Cora's kitten weighed 550 grams. On the second visit, the kitten had gained 350 grams. On the third visit, the
What was the advantage of the location of byzantine empire's capital.
PLEASE HELP WILL GIVE BRAINLIEST
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Write the equation of a line that is perpendicular towards y = -6x +5
A company's environmental sustainability strategy: ____________ a. is incompatible with the triple-bottom-line approach because it does not take into account p
why is the high court and the supreme court of India known as the court of the records?
2x²+3x-5=0 квадрані рівняння
what is 868277.5 divided by 80? i am stumped lol
True or False. What makes faith genuine is its object.