Uniquee312
Uniquee312 Uniquee312
  • 22-02-2021
  • Mathematics
contestada

2 (X+3)
What is x ?

PLS HELP ASAP

Respuesta :

abdiaziizmaahir338
abdiaziizmaahir338 abdiaziizmaahir338
  • 22-02-2021

Step-by-step explanation:

2(x+3)

2x+6

devide each in 2

2x/2 and 6/2

2 and 2 go out

X=3

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Los lunes Jorge ____________________ al centro comercial. a. van c. vas b. vamos d. va Please select the best answer from the choices provided A B C D
How many veins and arteries are present between the maternal and the fetal circulatory system by the fifth week of pregnancy?
Selim's restructuring of ottoman forces led to _________
Please help I will reward brainly. This needs done now Thanks
Angela invest $2550 at 3% interest rate compounded annually. What will the balance in the account be after 1.5 years? A)$2,626,50 B)$2,664.75 C)$2,665.61 D)$4,7
true or false Rise is the vertical change between any two points on a line
The process of making mRNA
WILL MARK BRAINILEST AND GIVE 15 POINTS! A rectangle has vertices at these coordinates. (−6, 3), (−6, 5), (2, 3) What are the coordinates of the fourth vertex
The brave men, living and dead, who struggled here, have consecrated it far above our poor power to add or detract. The world will little note, nor long remembe