Seudónimo Seudónimo
  • 24-02-2021
  • Geography
contestada

Why is deforestation bad?

Respuesta :

natalieenzweiler natalieenzweiler
  • 24-02-2021

Answer:But the risks from deforestation go even wider. Trees absorb and store carbon dioxide. If forests are cleared, or even disturbed, they release carbon dioxide and other greenhouse gases. Forest loss and damage is the cause of around 10% of global warming.

Explanation: i just took a test

mark me brainlist plz hope i helped

Answer Link

Otras preguntas

A number triple and tripped again is 729 what is the number show workings
if you are given a 2% raise and inflation rate is 3% you are
What event takes place in the second entry of Anne Frank's dairy?
How do short-term goals differ from long-term goals?
what would you call a object that makes people shut up
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Piaget believed that language helped foster cognitive development. Please select the best answer from the choices provided True or False
Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !
what are examples of processing large data using web technologies
Please help me answer these questions