angiesdz03 angiesdz03

25-02-2021
Mathematics

contestada

If AABE - AACD by the SAS similarity theorem, what is
AD?
16 units
20 units
24 units
28 units

If AABE AACD by the SAS similarity theorem what is AD 16 units 20 units 24 units 28 units class=

Respuesta :

gracielacarreno26 gracielacarreno26

26-02-2021

Answer:

C 24

Step-by-step explanation:

Answer Link

trufait18 trufait18

09-04-2021

Answer:

c

Step-by-step explanation:

got it right on test

Answer Link

Otras preguntas

Selim is a sales manager for the Bratney Companies, a company that manufactures equipment used in the processing of grains and other produce. Every year, Selim

The standard deviation of all possible x values is called the _____.

what does the new thompkins well look like in the book a drop of hope

If D varies directly with t and D is 105 when t is 3, find D when t is 8. 35 280 840

describe the various ways in which the natural and the fantastic both play a role in the stir “Jason’s and the Argonauts.

After six years which is the total amount of a compound interest investment of $35,000 at 4% interest compounded quarterly?

Carla works hard to get As on her report card because it is personally rewarding. Her behavior is being influenced by ____. drive-reduction theory intrinsic mot

The weight of an organ in adult males has a bell-shaped distribution with a mean of 330 grams and a standard deviation of 15 grams. Use the empirical rule to d

Help is Here, a wrecker company, will soon need to purchase a new wrecker. The company anticipates needing $35,000 in 3 years. Their credit union offers an acco

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc