studentinquiry studentinquiry
  • 23-03-2021
  • Biology
contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

181103
181103 181103
  • 23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

In the late 1700s, the Industrial Revolution developed in Britain because Britain (1) possessed key factors of production (2) excluded foreign investors (3) sup
Great literature is educational because it? A. teaches rather than entertains. B. helps you draw on ideas you already have. C. allows you to
What is the value of the digit 9 in the number 913,256?
what number is equivalent to 4.054
which type of social networking site limits you to a 140 character status updates?
A firm owned by a single person who shares profits and losses with no one else is a __________.
what goes into 80 and 11
An organism that produces its food by photosynthesis
33 / 36 in the simplest form
which digit has the same value in both numbers? what is the value of that digit 123456789. 987654321