ashleymendieta ashleymendieta

25-03-2021
Physics

contestada

who organized the modern periodic table?
A) Dalton
B) Mendeleev
C) Rutherford
D) Thomas

Respuesta :

caedencenz67 caedencenz67

25-03-2021

Answer:

Mendeleev

Explanation:

He discovered the periodic table trying to organize the elements in 1869

Answer Link

Otras preguntas

Write an explanatory essay that uses text evidence to answer the question posed by the title: Why did Jabeen Akhtar lie to everyone in high school about knowing

write an equation of a line that passes through each pair of points. (4,-8),(0,-2)

Mateo wants to learn to skateboard like his dad. He gets his first skateboard when he is seven, but his mom is concerned about him having an accident. What migh

What organization did General George Marshall create to fill the need for additional manpower, even after the draft? A. Women's Auxiliary Army Corps B. Bracero

Quill The birds are chirping. Their chirping wakes up the tiger.

Give an example of how one person could be involved in a civil lawsuit and a criminal lawsuit for the same action. What are the respective standards of proof fo

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Evaluate the expression 7+(-2)•3^2

transporte? Oral Assessment: You just arrived in a Spanish-speaking country to study abroad. You are excited, but you are a little frustrated because there was

Application problem with a linear function: Finding a coordinate given the slope and a point