tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

In your opinion, did the United States and Native Americans maintain a cooperative and mutually beneficial relationship in the period from 1783 to 1840?

Which of these conditions is most likely to exist in a recession or a depression? A. More production B. More income and spending C. More unemployment D. Higher

How did Japanese feudalism differ from Western European feudalism with regard to war? A. Japanese warriors were not permitted to own land, while knights were gi

If the 7th of an AP is equal to 11 times the 11th term, find the 18th term

please help business

If one is injured during the process of saving a life, the person who was trying to help is protected by what law?

Which expression is equivalent to the expression below?(6c^2+3c/-4c+2)/(2c+1/4c-2)

Which of the following are behaviors are often result from drug use

The main disadvantage of a general partnership isa.the unlimited liability of the partnersb.disagreement among partnersc.shared managementd.difficulty of

what is photosynthesis