scwarrior25p32ww3 scwarrior25p32ww3
  • 26-03-2021
  • Geography
contestada

The atmosphere on Mars is mostly made up of carbon dioxide, and the surface of the planet is too cold for humans to
handle.
O True
False

Respuesta :

chancewaltz
chancewaltz chancewaltz
  • 26-03-2021

Answer:

False

Explanation:

Answer Link
7537948 7537948
  • 26-03-2021

Answer:

true

Explanation:    

Answer Link

Otras preguntas

A birdie with a mass of 0.005 kg is served at a speed of 90 m/s (This is over 200 mph!). Determine its kinetic energy. A) 0.001125 J. B) 0.45 J. C) 20.25 J. D)
In 1947, British India was partitioned into two independent nation states
2. How was the Greek afterlife different from the Egyptians? helpppp pleaseee
Can someone plz help me?
Lyn moves to a new flat. These are the amounts she spends each month on rent and bills. Bills Rent £138 £679 Calculate the total of these amounts.​
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
No spam or leaksconstraints are the limits that we place on a design. Time, materials, or money may be in short supply. Some designs may also be mited by how th
¿Cómo son ustedes? Write two complete sentences describing yourself and one of your friends. Follow the model.
A sequence is a list ______. Each number in the list was called_________.
The Constitution establishes three branches of government that share identical powers. have different powers. are led by the legislative branch. are led by the