lilteetee07
lilteetee07 lilteetee07
  • 26-03-2021
  • Mathematics
contestada

what is this equal to
[tex] \frac{a + 8}{2} = \frac{a - 4}{8} [/tex]
​

Respuesta :

jocelyn378892 jocelyn378892
  • 26-03-2021
The answer is bc you do 8(a+8)=2(a-4) then it turns to 8a+64=2(a-4) to 8a-2a+64=-8 to 6a=-8-64 to 6a=-72 to the answer A=-12
Answer Link

Otras preguntas

Taxation without representation was a reason the colonists went to war with England true or false
What is 11.5 of 350?
Decide whether each sentence below is punctuated correctly. Use the drop-down menus to choose which revisions, if any, are necessary.
DNA tacaggtacccgaacccaattta
Firewood is stacked in a pile. The bottom row has 20 logs, and the top row was 14 logs. Each row has one more log than the row above it. How many logs are in th
Which of the equations below could be the equation of this parabola?
So far Carmela has collected 14 boxes of baseball coach there are 315 cards in each box Carmella estimate says she has about 3000 cards so she buys six albums t
How were the maya city-states connected
Divide mentally 270 divide 3=
Which if the following shows a similarity in the business practices of John D. Rockefeller and Andrew carnegie l? A. Both formed important steel companies B. Bo