thrashmanjoehi thrashmanjoehi
  • 22-04-2021
  • Mathematics
contestada

hellllllp asap!!!!!!!!!!

hellllllp asap class=

Respuesta :

rolandamt7 rolandamt7
  • 22-04-2021

Answer:

the answer should be 5.1

Step-by-step explanation:

Answer Link

Otras preguntas

7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
choose the correct helping verb the tadpoles have or had moved into the pond
6 is 12% of what number
When is cash pulled out of circulation
what feature of a confederal system did the confederate states of america most want
A number tripled and tripled again is 729 what is the number
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
only question 4 thank you
Three differences and one similarity between Shakespeare world and our own