bsbsjsj76 bsbsjsj76
  • 26-04-2021
  • Mathematics
contestada

The radius of a cylindrical water tank is 6.5 ft, and its height is 11 ft. What is the volume of the tank?

Respuesta :

maddiemaes564
maddiemaes564 maddiemaes564
  • 26-04-2021

Answer:

Step By Step explanation:

Ver imagen maddiemaes564
Answer Link

Otras preguntas

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
- - - - - - - - - - - - - - - - - - - - - - - - -
How do I make a line plot using data I collected.
Find the projection of u = <–6, –7> onto v = <1, 1> a. <-13/2,-13/2> b. <39,91/2> c. <-13/1764,-13/1764> d. <-2/13,-2/13>
Write out the form of the partial fraction decomposition of the function (as in this example). Do not determine the numerical values of the coefficients. ) x2 x
pasagot po please! FILIPINO PO ITO​
two thirds take away one half
Encuentra el resultado de la ecuación mediante la formula general
A and B contributed 2700 and 1800 respectively to start a business. They agreed to share the profit in the ratio 7:5 respectively. If the profit made was 900, C
Read Richard’s personal narrative. Elsie is my best friend. We’ve lived next door to each other since we were babies. Her mom and my mom are best friends. Elsie