catmeowanddoadance catmeowanddoadance
  • 24-05-2021
  • Mathematics
contestada

find the measure of exterior angle 1

find the measure of exterior angle 1 class=

Respuesta :

gioswt08
gioswt08 gioswt08
  • 24-05-2021

Answer:

Exterior angle= a+b

=80°+65°

=D. 145°

Answer Link

Otras preguntas

The europhoric state caused by is due to a dangerous lack of oxygen to the brain
What's a simple method to find the cube root of a number ?
Color ___ indicates that one color is dominating a picture.
what finger does the ring go on
what does hafa adai mean in guamanian
he percentage of children living in single-parent households in America’s five most populated cities is: Philadelphia 40.4%, New York, 30.5 %, Chicago 32.2%, Ho
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
In hexagonal writing and analysis of literary devices explores
Nathan is buying a cell phone for his business. The regular price of the cell phone is $179. If he buys the phone in the next 2 weeks, he will get a 20% discoun
PLEASE HELP ME AASSAPP