isiquezadagatica isiquezadagatica
  • 22-06-2021
  • Mathematics
contestada

Please, I just don't now waaaaa

Please I just dont now waaaaa class=

Respuesta :

zadieriver
zadieriver zadieriver
  • 22-06-2021
Respuestas :

A) 100km/h

B) 49km/h

C) 2.8 km/h

D) 500 m/s
Answer Link

Otras preguntas

Element X decays radioactively with a half life of 8 minutes. If there are 460 grams of Element X, how long, to the nearest tenth of a minute, would it take the
One of Tom's last acts is to _____. forgive Quimbo and Sambo curse his tormentors give misinformation about Cassy to send the chase in the wrong direction call
An advantage of using capital in the production process is that it:.
Explain how the thermal energy of an isolated system changes with time if the mechanical energy of that system is constant.​
Please help I will give brainliest
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Help please zjyjytbrbbrbrb
find the value of x a. 9 b. 10 c. 11 d. 12
Four friends want to take a vacation together, so each one gets a part-time job. Each person has 8 weeks to save $720 for the vacation. Analyze the four individ
What six characteristics does an object need to have to be considered a mineral?