lilianfarrar06 lilianfarrar06
  • 24-01-2022
  • Computers and Technology
contestada

Tom can use the _____ tool to make horizontal, vertical, elliptical and rectangular line selection. To select areas based on color, he should use the ___tool.

Respuesta :

nwnsv87cyc nwnsv87cyc
  • 24-01-2022

Answer:

Tom can use the Marquee tool to make horizontal, vertical, elliptical and rectangular line selection. To select areas based on color, he should use the Magic Wand tool.

Explanation:

Answer Link

Otras preguntas

what is the property of 6x=72
find the quotient of 3870 and 18
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what type of sentence tends to express a strong emotion
Explain the importance of spore formation for both eukaryotes and prokaryotes.
Use these words in a sentence proton neutron and isotope
1/3 x 1/5 in the simplest form
The europhoric state caused by is due to a dangerous lack of oxygen to the brain
If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold