lakeacha1 lakeacha1
  • 22-02-2022
  • Mathematics
contestada

Carlos is on the swim team. Each week he swim a total of 2000 meters. How many kilometers does he swim each week?

Respuesta :

jtm2588
jtm2588 jtm2588
  • 22-02-2022

Answer:

2 kilometers

Step-by-step explanation:

1000 meters = 1 kilometer

2000 meters = 2 kilometers

If you need to setup a conversion

[tex]\frac{2000m}{1}[/tex] × [tex]\frac{1km}{1000m}[/tex]

The meters cancel

[tex]\frac{2000km}{1000} \\[/tex]

Reduce

2 km

Answer Link

Otras preguntas

Name 3 things that marked life in the Jerusalem Church? ​
A pendulum is 22.9 inches long and the bob at the end of the pendulum travels 10.5 inches. Find the degree measure of the angle through which the pendulum swing
Plssssssssssssssssssssssssssssssss help
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
What mood is this sentence? Plants need air, water, sun, and soil to survive.
Help I don't understand balancing equations
Solve for h. A=8h Please help me
Which term is defined as the reversal of oceanic currents in the equatorial Pacific? O orography O EI Nino o La Nina o the Wilson Cycle
The Mariana Trench in the Pacific Ocean is 7,864 feet deeper than the Yap Trench. The Yap Trench is 27,976 feet deep. How deep is the Mariana Trench?
Why is there so much reading?