melisa10021 melisa10021

24-02-2022
Mathematics

contestada

The scale factor between two figures is 8/9
What is the ratio of their perimeters?

Respuesta :

househm71stu househm71stu

02-03-2022

Answer:

I think you want to us 7/9=x/21

cross multiply to get 9x =174

divide both sides by 9

x=16.3?

x being the perimeter

Step-by-step explanation:

Answer Link

Otras preguntas

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t

which loan type requires you to make loan payments while you're attending school? A-Unsubsidized federal loan. B-Subsidized federal loan. C-Pell Grant. D-None o

How do I do this? tell me the answer and how you got it.....I have to graph this later

how did Thomas Edison contribute to the Industrial Revolution

Tensile strength of a wound is directly related to the

Please I need help quickly I'm on a time limit

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Please explain how to find area of the rectangle pyramid.

A number tripled and tripled again is 729 what is the number

The gradient of a stream depends on its