savannnab1 savannnab1
  • 24-01-2017
  • History
contestada

the Pueblo Indians lived in what type of home

Respuesta :

roytucker
roytucker roytucker
  • 24-01-2017
pueblo Indians are American Indians who live in pueblos and have a long tradition of farming.
Answer Link

Otras preguntas

Raisins and nuts were mixed in a bowl. If nuts made up five eighths of the mixture, what was the ratio of raisins to nuts
How would you like to spend Christmas?Enjoy your holiday! (whatever you celebrate)
Swapna is 26 years older than her daughter Suma. 6 years later, Swapna will be thrice as old as Suma. Find their present ages.​
3. They love _______________ with their friends. A. eat out B. ate out C. having eaten D. to eat out
A high pressure system is present over San Francisco while a low pressure system is present over San Jose. In this case, winds will blow: Group of answer choice
John Brown a. leader of an 1831 slave revolt in Virginia b. author of UNCLE TOM'S CABIN c. operator of a station on the Underground Railroad d. first Republ
please help me on this​
Hello da 234234r32 ef3qew3e2wr3qefwasdwasd
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
compare the following number :- ▪︎ 3 × 10¹² and 4 × 10¹¹ I need a well explained solution,pls not from any other websites thx for answering~~​