naykambreea naykambreea

23-03-2022
Mathematics

contestada

A bookstore had 80 copies of a magazine. Yesterday, it sold 2/5 of them. Today, it sold 1/8 of what remained. How many copies does the bookstore have left?

Respuesta :

gurmplays55 gurmplays55

23-03-2022

Answer:

48 or 24

Step-by-step explanation:

Answer Link

Otras preguntas

what is thunder is cause by?

Color ___ indicates that one color is dominating a picture.

1+4=52+5=123+6=218+11=?

if you are given a 2% raise and inflation rate is 3% you are

Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?

E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p

What does the term human rights mean

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what are the chromosome numbers of daughter cells in mitosis and meiosis