alm3ahLishLore alm3ahLishLore

26-01-2017
Physics

contestada

A tape dispenser example wich simple machine

Respuesta :

finessekidtee finessekidtee

02-02-2017

The answer would be a pulley .

Answer Link

Otras preguntas

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

Mrs. Toomer brought 40 cookies to school. Mrs. Toomer's class ate 1/2 the cookies. Mrs. Wilson's class ate 1/4 of the remaining cookie. How many cookies are

What two cell types do complement proteins interact with, besides the pathogen itself?

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you

explain the conditions for cloud formation

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Helpp Pleasee ASAPPPPP

7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da

if probability of a win is 0.24 and the probability of a draw Is 0.16, what is the probability of a loss

Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination