lexijanayy2 lexijanayy2

25-04-2022
Mathematics

contestada

pls help for this question!!!

pls help for this question class=

Respuesta :

mycheekie09 mycheekie09

25-04-2022

Answer:

I think it would be 4+10=14 and the bigger number is 10

Step-by-step explanation:

forgive me if I'm wrong

Answer Link

Otras preguntas

Can you help me what year did pizarro and his crew arrived to south america and spread their disease

Determine if (−3, −26) and (3, 10) are solutions to the system of equations: 6x + y = 8, x2 − 5 = 4

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

The titration of an impure sample of KHP found that 35.00 mL of 0.050 M NaOH was required to react completely with 0.596 g of sample. What is the percentage of

The distinction between operating and nonoperating income relates to: a. Continuity of income b. Reliability of measurements c. Consistency of income stream d.

Please answer!!!!!!!!!!!!!!

The process of mRNA to protein is called

Computer programs can contain integrated coding within other code and stacked upon even more code, creating very large programs. Computers can also perform mill

What best characterizes the structure of Southern society? Southern opposition to slavery grew with the invention of the cotton gin. Yeoman farmers owned the la

Which of the following international operations strategies uses decentralized authority with substantial autonomy at each business? A. international B. global