iheartmayuu
iheartmayuu iheartmayuu
  • 24-05-2022
  • Mathematics
contestada

points, love?
What is the quadratic formula.
I dont care where you get the answer from.

Respuesta :

templayd000
templayd000 templayd000
  • 24-05-2022

Answer:

ax^2 + bx + c = 0

Step-by-step explanation:

Hope this helps! :)

Answer Link
zowiek1
zowiek1 zowiek1
  • 24-05-2022

Answer:

Definition of quadratic formula

: a formula that gives the solutions of the general quadratic equation ax2 + bx + c = 0 and that is usually written in the form x = (-b ± √(b2 − 4ac))/(2a)

Answer Link

Otras preguntas

what other fields of the study might contribute to knowledge and understanding in art history?
The height in inches of three boys is 54.0 48.5 46.0 respectively the height of the 4th boy is denoted by h inches the average height a of the 4 boys can be exp
Who is Christina LeConte
Which statement is true for single-celled organisms
im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?
What's 165% as a fraction and decimal
how to solve these question?
What happens as genes are passed on from parent to offspring over many generations?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th