cali91
cali91
26-05-2017
Mathematics
contestada
Please help me answer this
Respuesta :
kphung76127
kphung76127
26-05-2017
There are 300 mins in 5 hrs. 300 x 8.6 calories per minute = 2580 calories total
Answer Link
VER TODAS LAS RESPUESTAS ( 95+ )
Otras preguntas
Describe the challenges faced by Zebulon Plae and James Wanson
Which ordered pair is a solution to the system of linear equations One-half x minus three-fourths y = StartFraction 11 Over 60 EndFraction and Two-fifths x + on
You have learned several methods for solving a system of equations. First, rank the methods in order of preference, noting which one you would choose to solve a
A store sells posters. Each poster costs the same amount. During a sale, the store reduces the price of each poster by $1. 25. Caleb spends $17.76 on 4 posters
If the First National Bank has a gap equal to a negative $30 million, then a 5 percentage point increase in interest rates will cause profits to Question 4 opti
Which of the following is/are true of HIV? A) It has a longer incubation period than influenza. B) It can be transmitted before it can be detected by commonly
Case 1: An electron jumps from energy level 3 to energy level 7 in an atom. Case 2: An electron jumps from energy level 3 to energy level 9 in an atom. For ca
________ involves using introspection to investigate the components of the mind, whereas ________ involves the functions or purposes of the mind and behavior in
To be safe, the engineers making the ride want to be sure the normal force does not exceed 1.5 times each persons weight - and therefore adjust the frequency of
If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc​
