m3rk098 m3rk098

25-04-2018
Mathematics

contestada

hello can you please help me posted picture of question

hello can you please help me posted picture of question class=

Respuesta :

Professor1994 Professor1994

25-04-2018

4x^6+2x^5-2x+8+2x^8+4x+2=
2x^8+4x^6+2x^5+(4-2)x+10=
2x^8+4x^6+2x^5+2x+10

Answer: Option B: 2x^8+4x^6+2x^5+2x+10

Answer Link

Otras preguntas

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

What are two adjectives for the word Black hawk?

which branch of central government makes/enact/ passes laws

What hormones are related to sodium balance?

PLEASE HELP AND EXPLAIN!!! (ASAP) A freight train left Seoul and traveled north at an average speed of 15.6 km/h. A passenger train left 3.9 hours later and tra

What does Holden have against bald men?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

can organisms naturally repair a mutation?

What are the adaptive immune responses induced following acute and chronic infection with HIV?

Can anyone to correct it if necessary? Thank you.