DRock2068 DRock2068
  • 21-10-2021
  • Chemistry
contestada

What two factors must be held constant for density to be a constant ratio?

Respuesta :

adioabiola
adioabiola adioabiola
  • 25-10-2021

The two factors which must be held constant for density to be a constant ratio are: Mass and Volume

As we know, the density of a material is simply defined as the ratio of mass to volume.

  • In essence, Density = Mass/Volume

Consequently, To obtain a constant ratio for density, the mass and volume of the material in discuss must be kept constant.

Read more;

https://brainly.com/question/17780219

Answer Link

Otras preguntas

what is 38633x794 addition form!
What are your thoughts and opinions on this?
What does this allusion reveal about McCandless? Explain.
A Collage is made by?​
In their last game, the New England Patriots scored 9 points in the first half. In the second half, they scored twice the amount of points in the first half. Wh
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
¿Por qué quiere comprar una pelota de voleibol Esmeralda? la pelota explotó un chico robó la pelota O O ya no tiene una
¿Qué quiere decir "evitar posibles goles fantasma"?
Hannah has $2 worth of dimes and quarters. She has a total of 17 dimes and quarters altogether. By following the steps below, determine the number of dimes, x,x
Can the following properties of figures change when transformed with a rigid motion? Move each letter a-h to the appropriate box.A. Side LengthsB. Slope of a Si