Seudónimo Seudónimo
  • 24-01-2017
  • Social Studies
contestada

Resources that were created over millions of years from the remains of prehistoric plants and animals are called

Respuesta :

grav3yardbaby
grav3yardbaby grav3yardbaby
  • 24-01-2017
fossil fuels is what you would call that
Answer Link
kingcrazytaco
kingcrazytaco kingcrazytaco
  • 24-01-2017
fossil fuels were created
Answer Link

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Simplify 25 ÷ 7 5/14 14/5 2/35 14/35 It is about dividing fractions, plz help!
HELP PLZZZZ !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
100 point " Among the hidden " Question plus brainliest for correct answer, I will report if i have too.
EMERGENCY! What is true about the height of a triangle? A It measures the distance from the base to the highest point in the triangle. B It is perpendicular to
Work out the perimeter of the shaded shape.
ssment 1/10 What can help you meet your budget while shopping for important items? Buying the item with the best features. Making a list of your wants to meet y
All of the following have been a part of the Green party’s platform EXCEPT: A. community leadership B. support for nuclear power C. racial justice for all citiz
(Sample answers needed) I will mark brainliest :) 20 pts What was the importance of Axum to Ethiopia?
wut is 9-4-6-0-2-4-1=